Top » Catalog » SNPs » BY7402

$18.00

BY7402
[BY7402]

BY7402
hg38 Position: ChrY:21842985..21842985
Ancestral: A
Derived: G
Reference: FTDNA (2016)
ISOGG Haplogroup: E1b
Comments: Below V22 > CTS6080
Forward Primer: BY7402_F TCTCTGCCTCCCTTCATCG
Reverse Primer: BY7402_R TGGTAAACTAGCCTCTGTTTCCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies