Top » Catalog » SNPs » YSC0000221

$18.00

YSC0000221
[YSC0000221]

YSC0000221
hg38 Position: ChrY:19315024..19315024
Ancestral: T
Derived: G
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R
Comments: Derived in HUGO
Forward Primer: YSC0000221_F CAAAAATTGCTAGGGCAGAG
Reverse Primer: YSC0000221_R TTGCAATAGTTTGGGGGAAG
Reviews

Customers who bought this product also purchased
A324
A324
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies