Top » Catalog » SNPs » Y47739

$19.00

Y47739
[Y47739]

Y47739
hg38 Position: ChrY:8816004..8816004
Ancestral: G
Derived: A
Reference: YFull (2015)
ISOGG Haplogroup: I2
Comments: Below PH908
Forward Primer: Y47739_F TTTCCTTCTTTTGCCTTTCTGG
Reverse Primer: Y47739_R GGATATCCCACCTAAACCACAAAG
Reviews

Customers who bought this product also purchased
Y55954
Y55954
Y55817
Y55817
Y51455
Y51455
Y48047
Y48047
Y49080
Y49080
Y47724
Y47724
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies