Top » Catalog » SNPs » Y52621

$18.00

Y52621
[Y52621]

Y52621
hg38 Position: ChrY:14870378..14870378
Ancestral: C
Derived: A
Reference: YFull (2015)
ISOGG Haplogroup: I2
Comments: Below S17250
Forward Primer: Y52621_F TCCCAGGCACTGTAGGGTATC
Reverse Primer: Y52621_R CAACCCGTAACTGCTACACTG
Reviews

Customers who bought this product also purchased
A493
A493
A21278
A21278
A10959
A10959
Y12075
Y12075
Z17855
Z17855
A8740
A8740
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies