Top » Catalog » SNPs » Y52621

$18.00

Y52621
[Y52621]

Y52621
hg38 Position: ChrY:14870378..14870378
Ancestral: C
Derived: A
Reference: YFull (2015)
ISOGG Haplogroup: I2
Comments: Below S17250
Forward Primer: Y52621_F TCCCAGGCACTGTAGGGTATC
Reverse Primer: Y52621_R CAACCCGTAACTGCTACACTG
Reviews

Customers who bought this product also purchased
FT177529
FT177529
BY106777
BY106777
BY183912
BY183912
FGC7126
FGC7126
Y97246
Y97246
A811
A811
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies