Top » Catalog » SNPs » Y52621

$18.00

Y52621
[Y52621]

Y52621
hg38 Position: ChrY:14870378..14870378
Ancestral: C
Derived: A
Reference: YFull (2015)
ISOGG Haplogroup: I2
Comments: Below S17250
Forward Primer: Y52621_F TCCCAGGCACTGTAGGGTATC
Reverse Primer: Y52621_R CAACCCGTAACTGCTACACTG
Reviews

Customers who bought this product also purchased
Y140541
Y140541
Y162454
Y162454
Y12073
Y12073
Y5595
Y5595
A5877
A5877
Y3118
Y3118
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies