Top » Catalog » SNPs » Y52621

$18.00

Y52621
[Y52621]

Y52621
hg38 Position: ChrY:14870378..14870378
Ancestral: C
Derived: A
Reference: YFull (2015)
ISOGG Haplogroup: I2
Comments: Below S17250
Forward Primer: Y52621_F TCCCAGGCACTGTAGGGTATC
Reverse Primer: Y52621_R CAACCCGTAACTGCTACACTG
Reviews

Customers who bought this product also purchased
FT177529
FT177529
Y134603
Y134603
A14973
A14973
L1498
L1498
A20333
A20333
FGC30452
FGC30452
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies