Top » Catalog » SNPs » ZS7093

$18.00

ZS7093
[ZS7093]

ZS7093
hg38 Position: ChrY:9200996..9200996
Ancestral: G
Derived: C
Reference: Victar Mas (2015)
ISOGG Haplogroup: J1
Comments: Corrected by submitter. Previously ChrY:19264170 C to T. Now: downstream FGC2
Forward Primer: ZS7093_F AACAGGTCTACGTAGCATTATTAGAAAAG
Reverse Primer: ZS7093_R AAACACAGGTAGTGATACAGACAATTATG
Reviews

Customers who bought this product also purchased
ZS7528
ZS7528
FGC1713
FGC1713
ZS9542
ZS9542
Y22089
Y22089
Y36224
Y36224
ZS7531
ZS7531
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies