Top » Catalog » SNPs » ZS7093

$18.00

ZS7093
[ZS7093]

ZS7093
hg38 Position: ChrY:9200996..9200996
Ancestral: G
Derived: C
Reference: Victar Mas (2015)
ISOGG Haplogroup: J1
Comments: Corrected by submitter. Previously ChrY:19264170 C to T. Now: downstream FGC2
Forward Primer: ZS7093_F AACAGGTCTACGTAGCATTATTAGAAAAG
Reverse Primer: ZS7093_R AAACACAGGTAGTGATACAGACAATTATG
Reviews

Customers who bought this product also purchased
FT272187
FT272187
ZS8815
ZS8815
ZS8325
ZS8325
A25928
A25928
BY8
BY8
BY4
BY4
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies