Top » Catalog » SNPs » ZS10833

$18.00

ZS10833
[ZS10833]

ZS10833
hg38 Position: ChrY:19692240..19692240
Ancestral: G
Derived: A
Reference: Victar Mas (2016)
ISOGG Haplogroup: J1
Comments: downstream FGC8701
Forward Primer: ZS10833_F GGTTAAAAGTGATCTGTGGCACC
Reverse Primer: ZS10833_R ATTTTAGCACTTTCAACATGTCATC
Reviews

Customers who bought this product also purchased
FT239596
FT239596
BY50476
BY50476
L859
L859
J1-M267 Superclade Panel
J1-M267 Superclade Panel
ZS5868
ZS5868
FGC11
FGC11
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies