Top » Catalog » SNPs » ZS10833

$18.00

ZS10833
[ZS10833]

ZS10833
hg38 Position: ChrY:19692240..19692240
Ancestral: G
Derived: A
Reference: Victar Mas (2016)
ISOGG Haplogroup: J1
Comments: downstream FGC8701
Forward Primer: ZS10833_F GGTTAAAAGTGATCTGTGGCACC
Reverse Primer: ZS10833_R ATTTTAGCACTTTCAACATGTCATC
Reviews

Customers who bought this product also purchased
L859
L859
FT239596
FT239596
BY50476
BY50476
FGC12
FGC12
ZS5871
ZS5871
FGC5
FGC5
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies