Top » Catalog » SNPs » BY5570

$18.00

BY5570
[BY5570]

BY5570
hg38 Position: ChrY:11686711..11686711
Ancestral: G
Derived: T
Reference: FTDNA (2016)
ISOGG Haplogroup: E1b1b
Comments: Z5018 > S2979 > Z16659 > L241 > A7065
Forward Primer: BY5570_F GATGGAATGGAATGGACAGG
Reverse Primer: BY5570_R TCCTGTTCATTCCATTCCAGTAC
Reviews

Customers who bought this product also purchased
Z5018
Z5018
BY167143
BY167143
BY5677
BY5677
Z16242
Z16242
FGC11457
FGC11457
Z5017
Z5017
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies