Top » Catalog » SNPs » A22947

$18.00

A22947
[A22947]

A22947
hg38 Position: ChrY:13892186..13892186
Ancestral:
Derived: T
Reference: William Flanders ( 2018)
ISOGG Haplogroup: R1b
Comments:
Forward Primer: A22947_F CAAGGACACTTTTAAATAGATTATTCAG
Reverse Primer: A22947_R CCCATACTCATGTAGATAATAGCTCCC
Reviews

Customers who bought this product also purchased
A22946
A22946
A22945
A22945
Prepaid Return Envelope
Prepaid Return Envelope
DNA Sample Kit
DNA Sample Kit
Wish a SNP
Wish a SNP
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies