Top » Catalog » SNPs » Y52453

$18.00

Y52453
[Y52453]

Y52453
hg38 Position: ChrY:14750595..14750595
Ancestral: C
Derived: A
Reference: YFull (2015)
ISOGG Haplogroup: J2
Comments: Below L283 > Z1296 > PH1751
Forward Primer: Y52453_F CAGGGTGCTGGGAGTAAGAC
Reverse Primer: Y52453_R GGTTTCTGTGTGTTATACTTCAAACTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies