Top » Catalog » SNPs » S5619

$18.00

S5619
[S5619]

S5619
hg38 Position: ChrY:16126619..16126619
Ancestral: C
Derived: T
Reference: Jim Wilson (2014)
ISOGG Haplogroup: I1a2b (no listed)
Comments: Aka FGC3500; found in at least 3 individuals in haplogroup I1-Z138
Forward Primer: S5619_F CCAGTCCCACAAAGGAGAAC
Reverse Primer: S5619_R TCCTGGTCCCTTAAAGGTTTG
Reviews

Customers who bought this product also purchased
FGC19383
FGC19383
FGC3459
FGC3459
A6849
A6849
I1 Superclade Panel
I1 Superclade Panel
FGC3500
FGC3500
Z58
Z58
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies