Top » Catalog » SNPs » YP4706

$18.00

YP4706
[YP4706]

YP4706
hg38 Position: ChrY:12180393..12180393
Ancestral: T
Derived: C
Reference: YDNA-community (2015)
ISOGG Haplogroup: R1a (not listed)
Comments: Below CTS 1211 > Y35 > YP4441
Forward Primer: YP4706_F CATGATACCAAAATTATTAATCCAAAGG
Reverse Primer: YP4706_R CCATCTTAGCTCCACCCCTG
Reviews

Customers who bought this product also purchased
YP237
YP237
YP4441
YP4441
L1280
L1280
YP4286
YP4286
BY3502
BY3502
Y2608
Y2608
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies