Top » Catalog » SNPs » YP4706

$18.00

YP4706
[YP4706]

YP4706
hg38 Position: ChrY:12180393..12180393
Ancestral: T
Derived: C
Reference: YDNA-community (2015)
ISOGG Haplogroup: R1a (not listed)
Comments: Below CTS 1211 > Y35 > YP4441
Forward Primer: YP4706_F CATGATACCAAAATTATTAATCCAAAGG
Reverse Primer: YP4706_R CCATCTTAGCTCCACCCCTG
Reviews

Customers who bought this product also purchased
YP4441
YP4441
L1280
L1280
YP4286
YP4286
BY3502
BY3502
Y2608
Y2608
R1a-Z280 Panel
R1a-Z280 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY17045
1 x Y95763
$36.00
Haplogroup Info
Other products
Currencies