Top » Catalog » SNPs » Y94204

$18.00

Y94204
[Y94204]

Y94204
hg38 Position: ChrY:13472544..13472544
Ancestral: A
Derived: T
Reference: YFull (2017)
ISOGG Haplogroup: I2
Comments: .
Forward Primer: Y94204_F AGTGGGCAAAGGACAAGAAC
Reverse Primer: Y94204_R GCCGCTTTTTCTTTATCCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies