Top » Catalog » SNPs » A23332

$18.00

A23332
[A23332]

A23332
hg38 Position: ChrY:13680978..13680978
Ancestral: C
Derived: T
Reference: Jules van Laar (2018)
ISOGG Haplogroup: I1
Comments: Below FGC19383
Forward Primer: A23332_F CTGATGAACAGGGAAATAACCG
Reverse Primer: A23332_R GTGAGAATTTCCAGCCATTGC
Reviews

Customers who bought this product also purchased
A23330
A23330
A23333
A23333
A23331
A23331
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies