Top » Catalog » SNPs » A23319

$18.00

A23319
[A23319]

A23319
hg38 Position: ChrY:12926290..12926290
Ancestral: C
Derived: A
Reference: Zdenko Markovic (2018)
ISOGG Haplogroup: I2
Comments: .
Forward Primer: A23319_F GCTCTTACCTTCTGGGATCCC
Reverse Primer: A23319_R TACAGACACTGAGGGAAATTCAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies