Top » Catalog » SNPs » BY34282

$18.00

BY34282
[BY34282]

BY34282
hg38 Position: ChrY:8074958..8074958
Ancestral: T
Derived: G
Reference: FTDNA (2018)
ISOGG Haplogroup: E1b
Comments: Below V13 > Z5017 > Z16988
Forward Primer: BY34282_F AGAGGTGAGTCACATATCCTGAATC
Reverse Primer: BY34282_R GCCTATCTTCTAGGTGAAGTGACTG
Reviews

Customers who bought this product also purchased
BY155589
BY155589
BY50887
BY50887
BY62310
BY62310
Z5018
Z5018
BY124165
BY124165
V13
V13
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies