Top » Catalog » SNPs » Z42554

$18.00

Z42554
[Z42554]

Z42554
hg38 Position: ChrY:6840239..6840239
Ancestral: T
Derived: A
Reference: Ray Banks (2016)
ISOGG Haplogroup: G2a
Comments: Below L1259 > L91 > Z42570
Forward Primer: Z42554_F GTACTACATCATTGGGAAGGCTTC
Reverse Primer: Z42554_R AACACATAAGAGTGACAAATTAGAAAATACG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies