Top » Catalog » SNPs » BY18132

$18.00

BY18132
[BY18132]

BY18132
hg38 Position: ChrY:7651924..7651924
Ancestral: G
Derived: A
Reference: FTDNA (2017)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: BY18132_F CCAGAGACCAGGCATCTCTG
Reverse Primer: BY18132_R CCCAATTCTTATACCATACTAGCTCAATAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC30566
1 x SK445
$36.00
Haplogroup Info
Other products
Currencies