Top » Catalog » SNPs » ZS6268

$18.00

ZS6268
[ZS6268]

ZS6268
hg38 Position: ChrY:12921501..12921501
Ancestral: A
Derived: G
Reference: Victar Mas (2015)
ISOGG Haplogroup: J1 (not listed)
Comments: downstream FGC4745
Forward Primer: ZS6268_F AGCTGTGTGGAATTCTGTTGTG
Reverse Primer: ZS6268_R TTATCGGGAGATAGCAGTACCC
Reviews

Customers who bought this product also purchased
L858
L858
FGC4737
FGC4737
J1-M267 Superclade Panel
J1-M267 Superclade Panel
FGC4745
FGC4745
ZS241
ZS241
ZS6411
ZS6411
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies