Top » Catalog » SNPs » ZS6268

$18.00

ZS6268
[ZS6268]

ZS6268
hg38 Position: ChrY:12921501..12921501
Ancestral: A
Derived: G
Reference: Victar Mas (2015)
ISOGG Haplogroup: J1 (not listed)
Comments: downstream FGC4745
Forward Primer: ZS6268_F AGCTGTGTGGAATTCTGTTGTG
Reverse Primer: ZS6268_R TTATCGGGAGATAGCAGTACCC
Reviews

Customers who bought this product also purchased
Z2324
Z2324
ZS6262
ZS6262
M267
M267
FGC4726
FGC4726
L858
L858
FGC4737
FGC4737
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies