Top » Catalog » SNPs » BY174087

$18.00

BY174087
[BY174087]

BY174087
hg38 Position: ChrY:8664365..8664365
Ancestral: T
Derived: C
Reference: Bruce Middleton ( 2018)
ISOGG Haplogroup: R1b
Comments: Downstream from U106 > BY35817 > BY154167
Forward Primer: BY174087_F CAGCACAAGGCAGCTCTTTAC
Reverse Primer: BY174087_R GTGATAAAACCATATCTGAGAACCG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y55120
1 x Z5715
$36.00
Haplogroup Info
Other products
Currencies