Top » Catalog » SNPs » FGC7362

$18.00

FGC7362
[FGC7362]

FGC7362
hg38 Position: ChrY:21270299..21270299
Ancestral: G
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: G2a2b2b1a (not listed)
Comments: Found in the Van Beurden sample
Forward Primer: FGC7362_F TCAGCAAACTGAACCCATTG
Reverse Primer: FGC7362_R TATTGCCTGATGGCTTAGGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies