Top » Catalog » SNPs » Y89241

$18.00

Y89241
[Y89241]

Y89241
hg38 Position: ChrY:9970322..9970322
Ancestral: C
Derived: T
Reference: YFull (2017)
ISOGG Haplogroup: I1
Comments: .
Forward Primer: Y89241_F CTGCCTGGTTATCTCTGATTCTC
Reverse Primer: Y89241_R CTACCTCTGGATATTATTACCAAGTTAATTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies