Top » Catalog » SNPs » HU625

$18.00

HU625
[HU625]

HU625
hg38 Position: ChrY:19600740..19600740
Ancestral: C
Derived: A
Reference: Faleh Al Hujailan (2018)
ISOGG Haplogroup: J1
Comments: Downstream PH1501
Forward Primer: HU625_F AAAAATCCAAGCCAAGGAAAG
Reverse Primer: HU625_R AAGGAAGTCACGAAGTGCAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies