Top » Catalog » SNPs » HU626

$18.00

HU626
[HU626]

HU626
hg38 Position: ChrY:21573654..21573654
Ancestral: T
Derived: A
Reference: Faleh Al Hujailan (2018)
ISOGG Haplogroup: J1
Comments: Downstream PH1501
Forward Primer: HU626_F AACATTCAGTAGTAACCACCCCG
Reverse Primer: HU626_R GTGGTGACACCTAACCCCG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies