Top » Catalog » SNPs » HU630

$18.00

HU630
[HU630]

HU630
hg38 Position: ChrY:7887923..7887923
Ancestral: G
Derived: C
Reference: Faleh Al Hujailan (2018)
ISOGG Haplogroup: J1
Comments: Downstream PH1501
Forward Primer: HU630_F CCTTTCTTTTCATATTGCTGCG
Reverse Primer: HU630_R ATCTATACTCAGATGCATCTAACCCTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies