Top » Catalog » SNPs » HU631

$18.00

HU631
[HU631]

HU631
hg38 Position: ChrY:8569920..8569920
Ancestral: G
Derived: A
Reference: Faleh Al Hujailan (2018)
ISOGG Haplogroup: J1
Comments: Downstream PH1501
Forward Primer: HU631_F TTGAATTTGGTTGCCAGCC
Reverse Primer: HU631_R AAACTGTCCAATTATTAAAACATCCATTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies