Top » Catalog » SNPs » HU633

$18.00

HU633
[HU633]

HU633
hg38 Position: ChrY:9577577..9577577
Ancestral: T
Derived: G
Reference: Faleh Al Hujailan (2018)
ISOGG Haplogroup: J1
Comments: Downstream PH1501
Forward Primer: HU633_F TGTACTTTTTGTATTTCTAAATCCTACAGTG
Reverse Primer: HU633_R TTTAAGGTGGTGTTAAGATATCCCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies