Top » Catalog » SNPs » DF99

$18.00

DF99
[DF99]

DF99
hg38 Position: ChrY:8961450..8961450
Ancestral: C
Derived: A
Reference: Andy Gierson (2013)
ISOGG Haplogroup: R1b1a1a2a1a2f
Comments: Aka S11987; downstream R-P312
Forward Primer: DF99_F CTATATGTCAACATTGTGGGGG
Reverse Primer: DF99_R GAATTAAAACATAATGTTTCATTTGGC
Reviews

Customers who bought this product also purchased
Y5049
Y5049
BY15479
BY15479
BY15478
BY15478
BY15482
BY15482
FGC17018
FGC17018
FGC17034
FGC17034
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies