Top » Catalog » SNPs » A9433

$18.00

A9433
[A9433]

A9433
hg38 Position: ChrY:2942441..2942441
Ancestral: T
Derived: G
Reference: Alex Williamson (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Below P312 > L642 > Z30600 > Z39302
Forward Primer: A9433_F GGCTGGTCTTGAAATCCTGAG
Reverse Primer: A9433_R GGAGGCTGAGGTGGAAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies