Top » Catalog » SNPs » BY161470

$18.00

BY161470
[BY161470]

BY161470
hg38 Position: ChrY:8925727..8925727
Ancestral: A
Derived: G
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: Below P312 > ZZ37 > ZZ38 > Z30600
Forward Primer: BY161470_F TTGGCCTGCCAAACTGC
Reverse Primer: BY161470_R GGAAAAGTCAAACCATCCAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies