Top » Catalog » SNPs » BY68281

$18.00

BY68281
[BY68281]

BY68281
hg38 Position: ChrY:7991780..7991780
Ancestral: A
Derived: G
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: Below DF90
Forward Primer: BY68281_F TTTTTGCCACATTCTTTCCAC
Reverse Primer: BY68281_R TTTCTCAGACTGGCCAACAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies