Top » Catalog » SNPs » FGC5534

$18.00

FGC5534
[FGC5534]

FGC5534
hg38 Position: ChrY:15962730..15962730
Ancestral: A
Derived: G
Reference: Full Genomes Inc. (2013)
ISOGG Haplogroup: R1b1a1a2a1a2c1~
Comments: Found in a R-DF13 person
Forward Primer: FGC5534_F ATACCATGGGCTTCCCTAGC
Reverse Primer: FGC5534_R CATCTCCCTCCTGAATGGTG
Reviews

Customers who bought this product also purchased
FGC5530
FGC5530
FGC5541
FGC5541
R1b-FGC5496 downstream
R1b-FGC5496 downstream
FGC5554
FGC5554
FGC5511
FGC5511
FGC5524
FGC5524
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies