Top » Catalog » SNPs » S6277

$18.00

S6277
[S6277]

S6277
hg38 Position: ChrY:20806906..20806906
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: I1a2b (no listed)
Comments: Found in a hg I1-Z138 person
Forward Primer: S6277_F ACCTGGACTTTGTTGGCTTG
Reverse Primer: S6277_R CACCCGGTAAACTTTTGTGG
Reviews

Customers who bought this product also purchased
Y190840
Y190840
S9940
S9940
S20289
S20289
Y16456
Y16456
A6613
A6613
FGC4433
FGC4433
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies