Top » Catalog » SNPs » B301

$18.00

B301
[B301]

B301
hg38 Position: ChrY:2888787..2888787
Ancestral: A
Derived: T
Reference: Karmin et al. (2015)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: B301_F CTGTATGGACCCCCAAAATG
Reverse Primer: B301_R GCTGGTGGGACAGAAGAAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies