Top » Catalog » SNPs » FGC9663

$18.00

FGC9663
[FGC9663]

FGC9663
hg38 Position: ChrY:16284739..16284739
Ancestral: C
Derived: A
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Downstream of R1b-DF13
Forward Primer: FGC9663_F ATAACAAAATCCCACAGACTGGG
Reverse Primer: FGC9663_R ATTAGCTGGACATAGTGATGCATATC
Reviews

Customers who bought this product also purchased
FGC9672
FGC9672
FGC9684
FGC9684
FGC9702
FGC9702
R1b-S1051 McCeney Panel
R1b-S1051 McCeney Panel
FGC9683
FGC9683
FGC9695
FGC9695
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies