Top » Catalog » SNPs » FGC5537

$18.00

FGC5537
[FGC5537]

FGC5537
hg38 Position: ChrY:16157186..16157186
Ancestral: G
Derived: A
Reference: Full Genomes Inc. (2013)
ISOGG Haplogroup: R1b1a1a2a1a2c1~
Comments: Found in a R-DF13 person
Forward Primer: FGC5537_F TTGCAAAGGGTGTGTCTAACC
Reverse Primer: FGC5537_R TTTGGTTGAGGTTGTCTCACAG
Reviews

Customers who bought this product also purchased
FGC5554
FGC5554
FGC5513
FGC5513
FGC5538
FGC5538
FGC5524
FGC5524
FGC5508
FGC5508
FGC5507
FGC5507
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies