Top » Catalog » SNPs » FGC5538

$18.00

FGC5538
[FGC5538]

FGC5538
hg38 Position: ChrY:16454094..16454094
Ancestral: C
Derived: T
Reference: Full Genomes Inc. (2013)
ISOGG Haplogroup: R1b1a1a2a1a2c1~
Comments: Found in a R-DF13 person. downstream of FGC5539
Forward Primer: FGC5538v2_F CAGTGACACAATCTTGGGTGATA
Reverse Primer: FGC5538v2_R GCAATGATGTCCTAGGTATAAGTGAG
Reviews

Customers who bought this product also purchased
A1487
A1487
FGC5496
FGC5496
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
DF49
DF49
A1298
A1298
L1335
L1335
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies