Top » Catalog » SNPs » FGC5539

$18.00

FGC5539
[FGC5539]

FGC5539
hg38 Position: ChrY:16730660..16730660
Ancestral: T
Derived: C
Reference: Full Genomes Inc. (2013)
ISOGG Haplogroup: R1b1a1a2a1a2c1~
Comments: Found in a R-DF13 person. downstream of FGC5521
Forward Primer: FGC5539_F TGGATTGCTCAATTGCTCTC
Reverse Primer: FGC5539_R TGAAGAGATTTTTGCCAGCAC
Reviews

Customers who bought this product also purchased
DF13
DF13
YFS444735
YFS444735
S1088
S1088
FGC5496
FGC5496
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
A1487
A1487
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies