Top » Catalog » SNPs » S1051

$19.00

S1051
[S1051]

S1051
hg38 Position: ChrY:14237224..14237224
Ancestral: C
Derived: T
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1a1i
Comments: Downstream of R1b-DF13
Forward Primer: S1051_F CCAACCTTTGTATTGTTCTTGGC
Reverse Primer: S1051_R GAAGAAGAGGGACAATTGAAGG
Reviews

Customers who bought this product also purchased
FGC52058
FGC52058
FGC20611
FGC20611
FGC43088
FGC43088
Y125244
Y125244
FT63450
FT63450
FGC42321
FGC42321
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies