Top » Catalog » SNPs » S1051

$18.00

S1051
[S1051]

S1051
hg38 Position: ChrY:14237224..14237224
Ancestral: C
Derived: T
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1a1i
Comments: Downstream of R1b-DF13
Forward Primer: S1051_F CCAACCTTTGTATTGTTCTTGGC
Reverse Primer: S1051_R GAAGAAGAGGGACAATTGAAGG
Reviews

Customers who bought this product also purchased
Z192
Z192
BY2806
BY2806
Z56
Z56
BY3958
BY3958
L2
L2
S1523
S1523
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x SK1593
1 x E331
1 x SK1696
1 x Q Superclade Panel
1 x F14544
1 x CTS6489
1 x I2a-M423 Panel
$277.00
Haplogroup Info
Other products
Currencies