Top » Catalog » SNPs » S1051

$18.00

S1051
[S1051]

S1051
hg38 Position: ChrY:14237224..14237224
Ancestral: C
Derived: T
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1a1i
Comments: Downstream of R1b-DF13
Forward Primer: S1051_F CCAACCTTTGTATTGTTCTTGGC
Reverse Primer: S1051_R GAAGAAGAGGGACAATTGAAGG
Reviews

Customers who bought this product also purchased
DF27
DF27
A1105
A1105
P312
P312
A1101
A1101
R1b-M343 Orientation Panel
R1b-M343 Orientation Panel
Z16886
Z16886
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies