Top » Catalog » SNPs » S1051

$18.00

S1051
[S1051]

S1051
hg38 Position: ChrY:14237224..14237224
Ancestral: C
Derived: T
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1a1i
Comments: Downstream of R1b-DF13
Forward Primer: S1051_F CCAACCTTTGTATTGTTCTTGGC
Reverse Primer: S1051_R GAAGAAGAGGGACAATTGAAGG
Reviews

Customers who bought this product also purchased
FGC17897
FGC17897
FGC17898
FGC17898
FGC19454
FGC19454
BY11922
BY11922
FGC42169
FGC42169
FGC30631
FGC30631
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies