Top » Catalog » SNPs » Z2542

$18.00

Z2542
[Z2542]

Z2542
hg38 Position: ChrY:15773697..15773697
Ancestral: C
Derived: T
Reference: Y DNA community
ISOGG Haplogroup: R1b1a1a2a1a2c1
Comments: Aka CTS8221; extracted from 1K & PGP datasets
Forward Primer: Z2542v2_F AGAGAAGGTGATGTGTCAGGATAAC
Reverse Primer: Z2542v2_R AGGGACACAATACACTGCAGAG
Reviews

Customers who bought this product also purchased
CTS241
CTS241
DNA Sample Kit
DNA Sample Kit
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A18435
1 x mtComplete
1 x mtUpgrade
$298.00
Haplogroup Info
Other products
Currencies