Top » Catalog » SNPs » CTS8704

$18.00

CTS8704
[CTS8704]

CTS8704
hg38 Position: ChrY:16045457..16045457
Ancestral: C
Derived: T
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: R1b1a2a1a2c1g (not listed)
Comments: Aka S6375; between DF21 and Z246
Forward Primer: CTS8704_F ACTACAGGTGCCTGACACCC
Reverse Primer: CTS8704_R AAATTGGTACCGGTCATTGTG
Reviews

Customers who bought this product also purchased
A459
A459
R1b-L1402/3 downstream
R1b-L1402/3 downstream
A421
A421
A426
A426
A420
A420
A425
A425
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies