Top » Catalog » SNPs » FGC1695

$18.00

FGC1695
[FGC1695]

FGC1695
hg38 Position: ChrY:3387027..3387027
Ancestral: C
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a1b1b1a2a1a1a1a1a1a
Comments: Downstream of J1-L858 and FGC11
Forward Primer: FGC1695_F CAATACCTGCTAGAAGCATAAGGC
Reverse Primer: FGC1695_R CAAAGAAGTGAGGTCACAGGG
Reviews

Customers who bought this product also purchased
FGC5230
FGC5230
DYS454
DYS454
CDY
CDY
DYS390
DYS390
Z2293
Z2293
YSEQ-Alpha-Beta
YSEQ-Alpha-Beta
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY35603
1 x BY35646
$36.00
Haplogroup Info
Other products
Currencies