Top » Catalog » SNPs » FGC1695

$18.00

FGC1695
[FGC1695]

FGC1695
hg38 Position: ChrY:3387027..3387027
Ancestral: C
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a1b1b1a2a1a1a1a1a1a
Comments: Downstream of J1-L858 and FGC11
Forward Primer: FGC1695_F CAATACCTGCTAGAAGCATAAGGC
Reverse Primer: FGC1695_R CAAAGAAGTGAGGTCACAGGG
Reviews

Customers who bought this product also purchased
ZS5604
ZS5604
ZS1576
ZS1576
ZS4020
ZS4020
ZS6067
ZS6067
Z18215
Z18215
BY93
BY93
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies