Top » Catalog » SNPs » FGC1695

$18.00

FGC1695
[FGC1695]

FGC1695
hg38 Position: ChrY:3387027..3387027
Ancestral: C
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a1b1b1a2a1a1a1a1a1a
Comments: Downstream of J1-L858 and FGC11
Forward Primer: FGC1695_F CAATACCTGCTAGAAGCATAAGGC
Reverse Primer: FGC1695_R CAAAGAAGTGAGGTCACAGGG
Reviews

Customers who bought this product also purchased
FGC6
FGC6
FGC7944
FGC7944
FGC4316
FGC4316
ZS9681
ZS9681
BY72
BY72
Y25838
Y25838
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies