Top » Catalog » SNPs » FGC1695

$18.00

FGC1695
[FGC1695]

FGC1695
hg38 Position: ChrY:3387027..3387027
Ancestral: C
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a1b1b1a2a1a1a1a1a1a
Comments: Downstream of J1-L858 and FGC11
Forward Primer: FGC1695_F CAATACCTGCTAGAAGCATAAGGC
Reverse Primer: FGC1695_R CAAAGAAGTGAGGTCACAGGG
Reviews

Customers who bought this product also purchased
FGC19909
FGC19909
M5649
M5649
ZS2518
ZS2518
PF4845
PF4845
SK1296
SK1296
Z2324
Z2324
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies